Skip to main content

Advertisement

Table 1 AB genotype rules for the Chinese data set

From: The prediction of virus mutation using neural networks and rough set techniques

Nucleotide Predicted Rule N sequence
position genotype   
N 33 T N 37=C CCCCCCCCCCCCCCCCCCCCCCCCCCTCCCCCCCCCCCCCCCCCC
N 44 T N 47=T GGTGGGTGGGGAGGAGGGGGGGGAGGAAAAAAAAAAGAAAGAA
N 53 G N 33=C GGGGGGGGGGGGGGGGGGGGGGGGGGGTGGGGGGGGGGGGGG
  T N 33=T  
N 68 C N 33=T GGGGGGGGGGGGGGGGGGGGGGGGGGGCGGGGGGGGGGGGGG
  G N 33=C  
N 146 G N 38=A AAAGGAAAAAAAAAAGAACAAAAAAAAAAAAAAAAAAAAAAAAA